Help
The webserver has top navigation bar with five buttons: Input Seq,
Seq Overview, G4 containing region, help,
and contact us.
When a user first accesses the site, they are automatically directed to the Input Seq page, which contains a textbox allowing a DNA sequence to be entered by typing or copying and pasting. In addition, the user is required to enter the parameters to be used in the calculation: the maximum loop length, the maximum bulge size, and the minimum estimated melting temperature (°C) for a G4 to be counted among the final ensemble. As well, the user is given the option of calculating G4regions for the complement of the entered sequence and must give the sequence an identifying label.
sequence:
TACGGGTAGGTGCCGGGTGGGGTGGGAACGTGGGTATACCTACGGGAGGGGGGGTGGGGGTCAA
parameters:
Name: example 1 Max loop: 7 Max bulge:
2 Min temp: 50 Also calculate
compliment sequence: no
Clicking the calculate button at the bottom of the screen initiates the calculate and brings the user to the Seq Overview page. The top part of this page contains an interactive Multiplicity Chart that plots folding multiplicity (the number of structural distinct G4s that incorporate a particular G residue into the core) as a function of residue number. Values are plotted in the same order as the sequence entered (i.e. 5’ to 3’). Note that if the calculate complement option is set to yes, the values for the complementary strand will be plotted 3’ to 5’, so that adjacent positions in the DNA duplex will be plotted adjacently in the chart.
The bottom of the figure contains a slider that allows the user to zoom in on specific regions of the nucleotide sequence. Additional sequences can be added by clicking the Input Seq button in the navigation bar (for example here, the Pu27 sequence from the human MYC promoter). All sequences can be plotted simultaneously in the Multiplicity Chart and can be toggled between visible/hidden by clicking the corresponding button at the top of the plot.
sequence:
TGGGGAGGGTGGGGAGGGTGGGGAAGG
parameters:
Name: MYC Pu27 Max loop: 7 Max bulge:
2 Min temp: 50 Also calculate
compliment sequence: no
The bottom of the Seq Overview page contains the list of sequences entered by the user. The right of each sequence are details and delete buttons.
The delete button deletes the particular sequence. The details button lists all G4CRs within the sequence, the multiplicity values of each position with the G4CR, the location of the G4CR within the sequence, the length of the G4CR, the guanine content of the G4CR, the total number of different G4s than can be formed within the G4CR, the total number that can form simultaneously (in tandem), and the minimum, median, and maximum estimated Tm values of the G4s within each G4CR. Example 1 contains two G4CRs:
The G4 containing region button in the navigation bar provides a similar table that includes all of the user’s sequences. The details button associated with each G4CR gives a list of every G4 formed by a G4CR, with core guanine residues indicated with capital letters, together with the starting and ending position and estimated Tm. Shown below are the details for the first G4CR of example 1:
The Download Result button located at the top of the Seq Overview page opens a new tab with the entirety of the results listed as text. The example 1 and MYC Pu27 datasets give:
The Delete Data button on the Seq Overview page deletes all sequences. The help button on the navigation bar reproduces this description of the webserver. The contact us button has the email address of the corresponding author and a link to the lab webpage. For security reasons, each of the users has a session of 14 days to access their input and calculated data once they first visit our server. The data is kept in our database for 14 days until the session expired, and all the information are automatically and permanently deleted.